Untitled

it’s past fucking midnight and my grandmother got up and keeps loudly tearing paper right next to my room

by the way the reason there’s paper tearing is because she reads books by fucking tearing them apart page by page as she moves through them instead of just flipping the pages like a normal human

@adipemdragon

this is what her room looks like on a good day

note how even the hardcovers arent safe

dude

In an Exorcist-style display of flexibility, owls can rotate their necks a maximum of 270 degrees without breaking blood vessels or tearing tendons. (Source)

never knew human anatomy was this fucked

cow bones by gary larson

so no head?

hmmm

I…..wow

Tag yourself I’m Jarrick’s falling noises

meme genre i like: real life images with video game UIs edited over them

have you got any examples?

I dug through my random images folder to find this. 

holy fuck this has a lot more notes than i remember

i’m speechless

This is how the system of white supremacy  operates. The media is used 2 create stereotypes like blk on blk crime.They need black men to fill jail cells for the Prison Indstrial complex

You know what? I’m tired of this. I do not know what exactly they are waiting for. I mean our government comes up with “reasons” to invade other countries, such as Syria, like their government is allegedly violating human rights or something like that. but… I mean for other countries, they do not even have to go deep to bomb the fuck out of this place, they can just look at our media. And this has been happening to people of color since the media has existed.

I’ll never forget this 👇🏾

Did a research project on this in undergrad and the results are extremely alarming because it’s not just in imagery, it’s in language used even in the law making process and within our own communities in a completely different way than expected.

Yuuuup talk about this in our media culture and society class where the exact same Katrina sample was used. White supremacy runs far too wide and too deep to be denied that it exists

Sony: Easy…. EASY….

Microsoft: Over a bit… now a little to the riiiight…

Nintendo: THREE HANDLES! NO! FOUR! MOTION DETECTOR STICK! A SCREEN A FUCKING SCREEN ON YOUR CONTROLLER

book: “she has naturally red hair”

screen adaptation:

book: “she has naturally curly hair”

screen adaptation:

book: “red hair, freckles”

screen adaptation:

Book: “she was black”

Movie adaptation:

Book: she was a lesbian

Screen adaptation:

Book: “…he asked calmly.”

Movie:

Book: “she was plain and not very attractive”

Film:

Book : She was …

Film:

None of the images will load but I know exactly what they all look like

My favorite thing about Tumblr glitches is that they’re never mundane enough to be forgotten about they ALWAYS hit everyone at once and they’re always weird shit like “the buttons stopped working,” or “the note counter disappeared for some fucking reason,” or

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

You got like six unique nucleotides so nice

OP is a virus from outer space

FUCK YOU OP

Lucky is evolving past his image form

D-Day (June 6, 1944)

*any dying character*: i’m just… i’m just gonna rest for a while… i’m really tired…

Me:

A hot bath can burn as many calories as a 30 minute walk. One study found that men who spent an hour in a 104-degree bath burned 140 calories, moderated their blood sugar levels throughout the following day, and displayed an anti-inflammatory response that’s usually associated with exercise. Source Source 2 Source 3

.

I miss “vintage” anime artstyles, it was plain and simple back then but nowadays all i see is a woman who’s supposedly 1000yrs old looking like she’s 12 or women/girls having such unrealistic body shapes i.e boobs being bigger than their whole damn head and looking like it would snap their spine in half irl, also waists so tiny you wonder if they even have all their organs intact. Boobs DON’T have to jiggle with every step you take pls i’m begging for some normal fucking animation here

Like these two characters are roughly around the same age what’s going on

Let’s talk about the anime that have been on air long enough to have started off seemingly appeasing / logical that have become overdeveloped, eye sore mess:

Nami from One Piece in 2004:

vs Nami from One Piece in 2017:

Would you believe this is the same character?

Example B, Orihime from Bleach 2005:

Vs Orihime from Bleach 2016:

Would you believe she is the same character and the same age as her first appearance?!

Absolutely bewildering.

Older animation aside from better [female] character design was also appeasing. Unlike what we get now.

Don’t even get me started on the loli’s. Just what the fuck.