Sequences of genes to be transferred (in multi-fasta format).

A folder holds all recipient genomes, one file per genome.

The mutation level of genes to be transferred. This can be specified either as a fixed value, or within a range (the 'mixed' mode). If the 'mixed' argument was provided, HgtSIM will randomly select a value between user specified minimum and maximum mutation levels to alter each gene transfer.

 # with fixed mutation level (e.g. 10%).
 HgtSIM -t genes.fasta -d distribution.txt -f input_genomes -r 1-0-1-1 -x fna -i 10

 # with 'mixed' mode (e.g. 5-25%)
 HgtSIM -t genes.fasta -d distribution.txt -f input_genomes -r 1-0-1-1 -x fna -mixed 5-25

The ratio of mutation categories (separated with dash). The default setting is '1-0-1-1'. Please refer to the publication (http://dx.doi.org/10.7717/peerj.4015) or the figure below for its setting.

The distribution of transfers to the recipient genomes. The first column refers to the recipient genomes(without file extension), followed by a list of genes to be transferred therein (separated with comma).

 BAD,AAM_03063,AKV_01007,AMAC_01196,AMAU_02632,AMS_01785
 BDS,AAM_00175,AKV_00943,AMAC_00215,AMAU_02085,AMS_01465
 BGC,AAM_00176,AKV_01272,AMAC_01576,AMAU_00617,AMS_02653
 BHS,AAM_00195,AKV_01273,AMAC_01674,AMAU_05963,AMS_03303
 BNM,AAM_00209,AKV_00282,AMAC_02914,AMAU_02414,AMS_03378
 BRT,AAM_00308,AKV_02353,AMAC_03303,AMAU_00830,AMS_01655

The flanking sequences to be added to the end of gene transfers. Can be specified with '-lf' and '-rf', the default value is None.

 # introduce gene transfers without adding flanking sequences
 HgtSIM -t genes.fasta -i 10 -d distribution.txt -f input_genomes -r 1-0-1-1 -x fna

 # or, add same pair of flanking sequences (e.g. 'TAGATGAGTGATTAGTTAGTTA') to all gene transfers
 HgtSIM -t genes.fasta -i 10 -d distribution.txt -f input_genomes -r 1-0-1-1 -x fna -lf TAGATGAGTGATTAGTTAGTTA -rf TAGATGAGTGATTAGTTAGTTA

 # or, add flanking sequences dynamically to the two ends of each gene transfer
 HgtSIM -t genes.fasta -i 10 -d distribution.txt -f input_genomes -r 1-0-1-1 -x fna -lf lf.fasta -rf rf.fasta

if you want to add flanking sequences dynamically to the gene transfers, you can specify the left and right side sequences in two multi-fasta files. The IDs of the flanking sequences need to be exactly the same to their corresponding gene transfers.

As an illustration, if you have four transfers, which are transfer_A, transfer_B, transfer_C and transfer_D. And you have provided the following two files:

lf.fasta

 >transfer_A
 AAAAAAAAAA
 >transfer_B
 TTT

rf.fasta

 >transfer_A
 GGGGGGG
 >transfer_C
 CCCCC

HgtSIM will then:

1. add 'AAAAAAAAAA' to the left and 'GGGGGGG' to the right end of transfer_A;
2. add 'TTT' to the left and nothing to the right end of transfer_B;
3. add nothing to the left and 'CCCCC' to the right end of transfer_C;
4. add nothing to boths end of transfer_D.

Transfers can be inserted only to the intergenic regions by specifying the 'keep_cds' option. The annotation files (in genbank format) of the recipient genomes are needed to enable this option.

1. on the top is the nc and aa identities between input and mutated sequences for each transfer.
2. followed by a summary of changed nucleotide bases for each transfer.